ID: 966186296

View in Genome Browser
Species Human (GRCh38)
Location 3:177229893-177229915
Sequence ATGTGGTCACATGTAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966186296_966186300 7 Left 966186296 3:177229893-177229915 CCTGTGTTTACATGTGACCACAT No data
Right 966186300 3:177229923-177229945 ATACAATCCTTTTTGGAAGAGGG No data
966186296_966186298 0 Left 966186296 3:177229893-177229915 CCTGTGTTTACATGTGACCACAT No data
Right 966186298 3:177229916-177229938 TGATTCTATACAATCCTTTTTGG No data
966186296_966186299 6 Left 966186296 3:177229893-177229915 CCTGTGTTTACATGTGACCACAT No data
Right 966186299 3:177229922-177229944 TATACAATCCTTTTTGGAAGAGG No data
966186296_966186301 8 Left 966186296 3:177229893-177229915 CCTGTGTTTACATGTGACCACAT No data
Right 966186301 3:177229924-177229946 TACAATCCTTTTTGGAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966186296 Original CRISPR ATGTGGTCACATGTAAACAC AGG (reversed) Intergenic
No off target data available for this crispr