ID: 966187047

View in Genome Browser
Species Human (GRCh38)
Location 3:177236779-177236801
Sequence TAGACATGGGTAAGCCCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966187047_966187051 -3 Left 966187047 3:177236779-177236801 CCATTAGGGCTTACCCATGTCTA No data
Right 966187051 3:177236799-177236821 CTAGTTCTCCTCTCATCCTAGGG No data
966187047_966187052 4 Left 966187047 3:177236779-177236801 CCATTAGGGCTTACCCATGTCTA No data
Right 966187052 3:177236806-177236828 TCCTCTCATCCTAGGGCACATGG No data
966187047_966187050 -4 Left 966187047 3:177236779-177236801 CCATTAGGGCTTACCCATGTCTA No data
Right 966187050 3:177236798-177236820 TCTAGTTCTCCTCTCATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966187047 Original CRISPR TAGACATGGGTAAGCCCTAA TGG (reversed) Intergenic
No off target data available for this crispr