ID: 966189402 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:177258624-177258646 |
| Sequence | GGACCAGGGGTAAAGGAAGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 966189402_966189408 | 2 | Left | 966189402 | 3:177258624-177258646 | CCTACTTCCTTTACCCCTGGTCC | No data | ||
| Right | 966189408 | 3:177258649-177258671 | TTTTCAGTTTCTCTGACTCTTGG | No data | ||||
| 966189402_966189409 | 19 | Left | 966189402 | 3:177258624-177258646 | CCTACTTCCTTTACCCCTGGTCC | No data | ||
| Right | 966189409 | 3:177258666-177258688 | TCTTGGTCAACTATGTGTTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 966189402 | Original CRISPR | GGACCAGGGGTAAAGGAAGT AGG (reversed) | Intergenic | ||