ID: 966189402

View in Genome Browser
Species Human (GRCh38)
Location 3:177258624-177258646
Sequence GGACCAGGGGTAAAGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966189402_966189408 2 Left 966189402 3:177258624-177258646 CCTACTTCCTTTACCCCTGGTCC No data
Right 966189408 3:177258649-177258671 TTTTCAGTTTCTCTGACTCTTGG No data
966189402_966189409 19 Left 966189402 3:177258624-177258646 CCTACTTCCTTTACCCCTGGTCC No data
Right 966189409 3:177258666-177258688 TCTTGGTCAACTATGTGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966189402 Original CRISPR GGACCAGGGGTAAAGGAAGT AGG (reversed) Intergenic