ID: 966191363

View in Genome Browser
Species Human (GRCh38)
Location 3:177274403-177274425
Sequence GAGCGTGGACATGATGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966191363_966191368 2 Left 966191363 3:177274403-177274425 CCTCTGCCATCATGTCCACGCTC No data
Right 966191368 3:177274428-177274450 AGACAGAAGAGAAAGGGCAATGG No data
966191363_966191366 -5 Left 966191363 3:177274403-177274425 CCTCTGCCATCATGTCCACGCTC No data
Right 966191366 3:177274421-177274443 CGCTCAAAGACAGAAGAGAAAGG No data
966191363_966191367 -4 Left 966191363 3:177274403-177274425 CCTCTGCCATCATGTCCACGCTC No data
Right 966191367 3:177274422-177274444 GCTCAAAGACAGAAGAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966191363 Original CRISPR GAGCGTGGACATGATGGCAG AGG (reversed) Intergenic
No off target data available for this crispr