ID: 966192263

View in Genome Browser
Species Human (GRCh38)
Location 3:177281887-177281909
Sequence ACTGCTCTAAATGATTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966192262_966192263 1 Left 966192262 3:177281863-177281885 CCATTTTTTTGAATTTAGAAAAC No data
Right 966192263 3:177281887-177281909 ACTGCTCTAAATGATTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966192263 Original CRISPR ACTGCTCTAAATGATTTTAA AGG Intergenic
No off target data available for this crispr