ID: 966194289

View in Genome Browser
Species Human (GRCh38)
Location 3:177298036-177298058
Sequence GTCCCATGGCACCACGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966194289_966194301 22 Left 966194289 3:177298036-177298058 CCTTTCCCGTGGTGCCATGGGAC 0: 1
1: 1
2: 1
3: 14
4: 112
Right 966194301 3:177298081-177298103 GGGTGATTTCTACTTGTTTGTGG 0: 1
1: 1
2: 3
3: 13
4: 192
966194289_966194302 23 Left 966194289 3:177298036-177298058 CCTTTCCCGTGGTGCCATGGGAC 0: 1
1: 1
2: 1
3: 14
4: 112
Right 966194302 3:177298082-177298104 GGTGATTTCTACTTGTTTGTGGG 0: 1
1: 1
2: 1
3: 21
4: 153
966194289_966194294 1 Left 966194289 3:177298036-177298058 CCTTTCCCGTGGTGCCATGGGAC 0: 1
1: 1
2: 1
3: 14
4: 112
Right 966194294 3:177298060-177298082 CACACTTGGCCCCCTCCTGCTGG 0: 1
1: 1
2: 4
3: 20
4: 194
966194289_966194295 2 Left 966194289 3:177298036-177298058 CCTTTCCCGTGGTGCCATGGGAC 0: 1
1: 1
2: 1
3: 14
4: 112
Right 966194295 3:177298061-177298083 ACACTTGGCCCCCTCCTGCTGGG 0: 1
1: 0
2: 5
3: 20
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966194289 Original CRISPR GTCCCATGGCACCACGGGAA AGG (reversed) Intergenic
900086742 1:902217-902239 GTCGCATGGCACCTCCGGAGGGG - Intergenic
901866304 1:12109300-12109322 GTCTCATGGCCACTCGGGAAAGG + Intronic
902645490 1:17795077-17795099 GCCCCATGCCACCCCAGGAATGG - Intronic
905136926 1:35807628-35807650 GCCGGAAGGCACCACGGGAATGG - Intergenic
905675324 1:39820637-39820659 CTCCCTCGGCACCACGGGACTGG - Intergenic
908367191 1:63437125-63437147 GAACCATGGAACCACAGGAAAGG + Exonic
916314958 1:163438753-163438775 GTCCCATGTCAACAAGGGAAGGG - Intergenic
920869904 1:209785322-209785344 GACCCATGCCACGAAGGGAAAGG + Intergenic
922067521 1:222158514-222158536 CTCCCAAGGGACCAAGGGAAGGG + Intergenic
922205093 1:223439286-223439308 GTCCCATGGCCACACCTGAATGG + Intergenic
1064622318 10:17228938-17228960 GTCCGGTGGCACCACGCCAAAGG - Intronic
1067720344 10:48723328-48723350 GTCCCATGGCCTCACTGAAATGG + Intronic
1068674568 10:59757521-59757543 GTCTCAGAGCCCCACGGGAAAGG + Intergenic
1070665202 10:78337759-78337781 GTGCCATGGCACAGTGGGAAAGG + Intergenic
1077334889 11:1998820-1998842 TTCCCATGGCCCCACCGGAAAGG + Intergenic
1082965274 11:58960544-58960566 TTGCCATGCCACCACGAGAAGGG + Intronic
1082978529 11:59099156-59099178 TTGCCATGCCACCACGAGAAGGG + Intergenic
1083710467 11:64545319-64545341 GTCCCAGAGCAGCATGGGAAAGG - Intergenic
1084943456 11:72626423-72626445 GCCCCATGGCCCCAAGGGAGTGG - Intronic
1085482108 11:76831173-76831195 GTCTCATGGGACAAGGGGAAGGG - Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1202817872 11_KI270721v1_random:54002-54024 TTCCCATGGCCCCACCGGAAAGG + Intergenic
1094713235 12:32986180-32986202 GTCCCATGGCGTCACGGGAAAGG + Intergenic
1096714859 12:53485190-53485212 TTCCCATAGCACCACGCCAAAGG + Exonic
1097878162 12:64662765-64662787 GTCCCATTTCAACACGGGATGGG - Intronic
1101823611 12:108203155-108203177 GTCCCTTGGCACCAGGGTAGGGG - Intronic
1103612150 12:122130330-122130352 CCACCATGGCACTACGGGAATGG - Intronic
1103674764 12:122646960-122646982 AGCACATGGCACCACGGGGAAGG - Intergenic
1120741129 14:88110168-88110190 GACACATGGCATCATGGGAATGG - Intergenic
1120831555 14:89001690-89001712 GTTCTATGGCTCCAAGGGAAGGG - Intergenic
1121234036 14:92379518-92379540 GAACCATGGCACCAGGGGCATGG + Intronic
1124622247 15:31280322-31280344 CTCCCATGGCTCCCCGGGGAGGG + Intergenic
1124829807 15:33137277-33137299 GTCCCATGGCAACAGGGAATGGG - Intronic
1125832443 15:42726385-42726407 GTCCCGTGGCCCCACGGCCAAGG + Exonic
1131975589 15:97942799-97942821 ATCCCATGGCAAAAGGGGAAAGG - Intergenic
1132069097 15:98759902-98759924 GTCTCACGGTACCACGGGACAGG - Intronic
1132224313 15:100128663-100128685 GTCCCATGGCCCCAGGAGAGAGG - Intronic
1134683286 16:16141514-16141536 GTCTCAGGGCACCAGGGGCAGGG - Exonic
1137492060 16:48941291-48941313 ATACCATGGCACCCCAGGAATGG + Intergenic
1138205124 16:55119018-55119040 GGCCCATGCCACCACATGAAGGG + Intergenic
1143927284 17:10383105-10383127 GTCCCAGGGCATCATGGGAAGGG + Intergenic
1144950030 17:18989065-18989087 GTCCCTTGGCAGCAAGGGGAGGG + Intronic
1147055752 17:37833606-37833628 GCCTCATTGCACCACGGGATGGG - Intergenic
1147862775 17:43533290-43533312 GTCCAAGGGCACCAGGGGCAGGG + Exonic
1148824891 17:50385382-50385404 GAACCATGGCACCAGGGTAAAGG - Intronic
1150008212 17:61482771-61482793 GTGCCATGGCAACATGGGGAGGG + Intronic
1151435254 17:74091620-74091642 ATCCCATGGCAAAAGGGGAAGGG + Intergenic
1152770301 17:82163443-82163465 GTGCCATGGCCTCACGGGAAAGG - Intronic
1154105552 18:11519484-11519506 GCCCCATGGCCACCCGGGAAGGG - Intergenic
1155918161 18:31576247-31576269 GCCCCATGGCACCACAGGGATGG + Intergenic
1158653519 18:59308397-59308419 CTCCCATGGCATAACGGGAGAGG - Intronic
1161216792 19:3098672-3098694 GTGCGGTGGCCCCACGGGAAGGG + Intronic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1165389979 19:35533324-35533346 GTCCCATGCCTCTACGGGGATGG + Intergenic
1165779158 19:38422229-38422251 GCCCCAAGGCACCACGGGAGAGG + Intronic
925295646 2:2774730-2774752 GTCCCAGGGGACCAAGGCAAGGG - Intergenic
927640376 2:24841879-24841901 GTCCCCAGGCACCACAGGGAGGG - Intronic
932091154 2:68807549-68807571 GTCCCATAGCTCAACTGGAATGG - Intronic
937317893 2:120943612-120943634 GTCCCAAAGCACCAGGGGCATGG - Intronic
941108713 2:161393402-161393424 CTCCCATGGCTCCAGGGGTAAGG - Intronic
942498751 2:176566039-176566061 AACCCATGGCAACAAGGGAAGGG + Intergenic
942678852 2:178455555-178455577 GTCCCAGGGCATCAGGAGAAAGG + Intronic
944058425 2:195547330-195547352 GGCCCATGGCAGCGCGGGACTGG - Intergenic
948601686 2:239111223-239111245 TTCTCATGGCCCCACGGGCATGG + Intronic
948913978 2:241020905-241020927 GTCCCCTGACACCACAGGACGGG + Intronic
948992619 2:241562494-241562516 GTCCCATGGGACCTCAGGGAGGG + Intronic
949031038 2:241797646-241797668 CTCCCATGGCAGCGCAGGAATGG + Intronic
1170407765 20:16056850-16056872 CTCACATGGCACCAGGGGCAAGG - Intergenic
1173589966 20:44217033-44217055 GTCCCATGGGACAACGGGGTCGG - Intergenic
1175991007 20:62789120-62789142 CTCCCAGGGGGCCACGGGAAGGG + Intergenic
1179912877 21:44459658-44459680 GTCCCCTGGCAGCAGGGAAAGGG - Exonic
1184302296 22:43568760-43568782 GTCCCATGTCCCCAAGGGCAGGG - Intronic
1184836897 22:47029256-47029278 GTCCCTGGGCCCCATGGGAAGGG - Intronic
1184836910 22:47029294-47029316 GTTCCCGGGCCCCACGGGAAGGG - Intronic
949734991 3:7161333-7161355 GACCCATGCCACAAAGGGAAAGG - Intronic
949982226 3:9508960-9508982 CGCCTCTGGCACCACGGGAATGG - Intronic
950799582 3:15539320-15539342 TTCCCATGTCCCCATGGGAAGGG + Intergenic
962114321 3:132486240-132486262 GCCACATGGCCCCACAGGAAAGG - Intronic
962605438 3:137029007-137029029 GTCTCATGGCCCCAGGGAAAGGG - Intergenic
965370498 3:167856082-167856104 CTCCCATGGCTCCCCGTGAAGGG - Intergenic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
966916064 3:184584622-184584644 CTCCCATGGCAGAACGGGTAGGG + Intronic
968832802 4:2941867-2941889 GGCCCATGCAACCACGGGCAAGG + Intronic
971280208 4:25236751-25236773 GACCCATGGCAAAACGGAAAAGG - Intronic
974987338 4:69044111-69044133 ATCTCTTGACACCACGGGAAGGG + Intronic
976992850 4:91390065-91390087 GTCCCTTTCCACCACTGGAAAGG - Intronic
977444148 4:97107538-97107560 GTCCCAAGGAATCAAGGGAAGGG + Intergenic
978414200 4:108458535-108458557 GTCCCATGGCAGGAGGTGAAAGG + Intergenic
981526963 4:145716224-145716246 GTCCCAGGTCACCATGAGAAAGG - Intronic
992641842 5:78774465-78774487 CTCCCATGGCACCAGGGCAAAGG + Intergenic
996464484 5:123783439-123783461 GTCCCAGGGCACAAGTGGAAGGG + Intergenic
999830146 5:155311118-155311140 GTCCCATGTCACCAAGGGCCTGG + Intergenic
1001768078 5:174270545-174270567 GTCCCATGGCAAAAGGTGAAAGG + Intergenic
1010816068 6:80359396-80359418 GTCCCAGTTCACCACGGGAAGGG - Intergenic
1016834085 6:148459596-148459618 GTTCTCTGGCACCTCGGGAATGG - Intronic
1018017651 6:159727057-159727079 GCCCCAGGGCATCACGGGAAGGG - Exonic
1020570320 7:9851757-9851779 CTCCACTGGCACCACGGGATGGG + Intergenic
1025019413 7:55468776-55468798 GCCCCAGGGTACCACGGGACAGG + Intronic
1025105076 7:56163881-56163903 TTCCCAAGGCAGCAGGGGAAAGG + Intergenic
1026776274 7:73232991-73233013 GCCCCATGGCTCCAGGGAAATGG - Intergenic
1027017128 7:74786360-74786382 GCCCCATGGCTCCAGGGAAATGG - Intronic
1027070897 7:75159572-75159594 GCCCCATGGCTCCAGGGAAATGG + Intergenic
1028338035 7:89681946-89681968 CTCTCAGGGCACCATGGGAAAGG - Intergenic
1029577470 7:101412881-101412903 GTCCCGTGTCACCAGGGCAATGG + Intronic
1031989569 7:128188906-128188928 GTCCCATGTCAGCCAGGGAACGG + Intergenic
1032845086 7:135745417-135745439 CTGCCAGGGCACCACTGGAAGGG - Intronic
1033146690 7:138877080-138877102 GTCCCATGGCAACATGGAAGAGG + Intronic
1033534697 7:142300898-142300920 CTCCCATGGCCCCACAGGCAAGG - Intergenic
1034359646 7:150483066-150483088 CTCCCAGGGCACCACTGGACAGG - Intergenic
1035699534 8:1627383-1627405 GTCCCTGGGCACCACGGGAGGGG + Intronic
1035704419 8:1664265-1664287 TACCCATGCCACCACGGGAAGGG - Intronic
1037628257 8:20627688-20627710 TTTCCATGGCAGCAGGGGAAAGG + Intergenic
1038097831 8:24335557-24335579 TTCCCTTGCCATCACGGGAAGGG + Exonic
1041696613 8:60742743-60742765 TTCCCATGGCACCAGGGGGCTGG - Exonic
1043480255 8:80645555-80645577 GTCACATATCACCAAGGGAATGG - Intronic
1048606438 8:135973483-135973505 ATCCCAGGGCAGCAAGGGAAAGG + Intergenic
1048774491 8:137931127-137931149 GTACCATGGCAACACTTGAACGG + Intergenic
1049835975 8:144735797-144735819 GTCCCATGGTACCCCGGCAGTGG - Intronic
1052927868 9:34032442-34032464 GTCCCAAGGCTTCACAGGAAAGG + Intronic
1055626053 9:78178603-78178625 GTCCCACGGTGCCACGGGAAAGG + Intergenic
1057602508 9:96471059-96471081 GTCCCAGGGCACCCCGGAAGAGG + Exonic
1060112464 9:120916496-120916518 ATCTCATGGAACCACGTGAAAGG + Intronic
1060540453 9:124426524-124426546 TTCTCAGGGCATCACGGGAAGGG + Intergenic
1061418025 9:130458568-130458590 GTCCCACGGCGCCACAGGAAAGG + Exonic
1061927202 9:133811803-133811825 ATCCCATGGCAACACGGGCGGGG + Intronic
1191927216 X:66326520-66326542 GTCCAATGGCTCCAGAGGAAGGG + Intergenic
1193569225 X:83121640-83121662 GTGCCATGGTACCATGGGTATGG + Intergenic
1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG + Intergenic
1201237271 Y:11923406-11923428 ATCCTATGGCATCATGGGAAAGG - Intergenic