ID: 966201015

View in Genome Browser
Species Human (GRCh38)
Location 3:177359674-177359696
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966201015_966201020 -8 Left 966201015 3:177359674-177359696 CCCTCGGCTCTGCAGCCTAAGAG No data
Right 966201020 3:177359689-177359711 CCTAAGAGGAAGGCCCCTGCAGG No data
966201015_966201021 -7 Left 966201015 3:177359674-177359696 CCCTCGGCTCTGCAGCCTAAGAG No data
Right 966201021 3:177359690-177359712 CTAAGAGGAAGGCCCCTGCAGGG No data
966201015_966201023 -3 Left 966201015 3:177359674-177359696 CCCTCGGCTCTGCAGCCTAAGAG No data
Right 966201023 3:177359694-177359716 GAGGAAGGCCCCTGCAGGGTGGG No data
966201015_966201032 10 Left 966201015 3:177359674-177359696 CCCTCGGCTCTGCAGCCTAAGAG No data
Right 966201032 3:177359707-177359729 GCAGGGTGGGGGAGGGAACAGGG No data
966201015_966201033 13 Left 966201015 3:177359674-177359696 CCCTCGGCTCTGCAGCCTAAGAG No data
Right 966201033 3:177359710-177359732 GGGTGGGGGAGGGAACAGGGAGG No data
966201015_966201027 3 Left 966201015 3:177359674-177359696 CCCTCGGCTCTGCAGCCTAAGAG No data
Right 966201027 3:177359700-177359722 GGCCCCTGCAGGGTGGGGGAGGG No data
966201015_966201022 -4 Left 966201015 3:177359674-177359696 CCCTCGGCTCTGCAGCCTAAGAG No data
Right 966201022 3:177359693-177359715 AGAGGAAGGCCCCTGCAGGGTGG No data
966201015_966201031 9 Left 966201015 3:177359674-177359696 CCCTCGGCTCTGCAGCCTAAGAG No data
Right 966201031 3:177359706-177359728 TGCAGGGTGGGGGAGGGAACAGG No data
966201015_966201025 -1 Left 966201015 3:177359674-177359696 CCCTCGGCTCTGCAGCCTAAGAG No data
Right 966201025 3:177359696-177359718 GGAAGGCCCCTGCAGGGTGGGGG No data
966201015_966201026 2 Left 966201015 3:177359674-177359696 CCCTCGGCTCTGCAGCCTAAGAG No data
Right 966201026 3:177359699-177359721 AGGCCCCTGCAGGGTGGGGGAGG No data
966201015_966201024 -2 Left 966201015 3:177359674-177359696 CCCTCGGCTCTGCAGCCTAAGAG No data
Right 966201024 3:177359695-177359717 AGGAAGGCCCCTGCAGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966201015 Original CRISPR CTCTTAGGCTGCAGAGCCGA GGG (reversed) Intergenic
No off target data available for this crispr