ID: 966201016

View in Genome Browser
Species Human (GRCh38)
Location 3:177359675-177359697
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966201016_966201023 -4 Left 966201016 3:177359675-177359697 CCTCGGCTCTGCAGCCTAAGAGG No data
Right 966201023 3:177359694-177359716 GAGGAAGGCCCCTGCAGGGTGGG No data
966201016_966201032 9 Left 966201016 3:177359675-177359697 CCTCGGCTCTGCAGCCTAAGAGG No data
Right 966201032 3:177359707-177359729 GCAGGGTGGGGGAGGGAACAGGG No data
966201016_966201027 2 Left 966201016 3:177359675-177359697 CCTCGGCTCTGCAGCCTAAGAGG No data
Right 966201027 3:177359700-177359722 GGCCCCTGCAGGGTGGGGGAGGG No data
966201016_966201022 -5 Left 966201016 3:177359675-177359697 CCTCGGCTCTGCAGCCTAAGAGG No data
Right 966201022 3:177359693-177359715 AGAGGAAGGCCCCTGCAGGGTGG No data
966201016_966201021 -8 Left 966201016 3:177359675-177359697 CCTCGGCTCTGCAGCCTAAGAGG No data
Right 966201021 3:177359690-177359712 CTAAGAGGAAGGCCCCTGCAGGG No data
966201016_966201020 -9 Left 966201016 3:177359675-177359697 CCTCGGCTCTGCAGCCTAAGAGG No data
Right 966201020 3:177359689-177359711 CCTAAGAGGAAGGCCCCTGCAGG No data
966201016_966201026 1 Left 966201016 3:177359675-177359697 CCTCGGCTCTGCAGCCTAAGAGG No data
Right 966201026 3:177359699-177359721 AGGCCCCTGCAGGGTGGGGGAGG No data
966201016_966201031 8 Left 966201016 3:177359675-177359697 CCTCGGCTCTGCAGCCTAAGAGG No data
Right 966201031 3:177359706-177359728 TGCAGGGTGGGGGAGGGAACAGG No data
966201016_966201033 12 Left 966201016 3:177359675-177359697 CCTCGGCTCTGCAGCCTAAGAGG No data
Right 966201033 3:177359710-177359732 GGGTGGGGGAGGGAACAGGGAGG No data
966201016_966201024 -3 Left 966201016 3:177359675-177359697 CCTCGGCTCTGCAGCCTAAGAGG No data
Right 966201024 3:177359695-177359717 AGGAAGGCCCCTGCAGGGTGGGG No data
966201016_966201025 -2 Left 966201016 3:177359675-177359697 CCTCGGCTCTGCAGCCTAAGAGG No data
Right 966201025 3:177359696-177359718 GGAAGGCCCCTGCAGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966201016 Original CRISPR CCTCTTAGGCTGCAGAGCCG AGG (reversed) Intergenic