ID: 966201023

View in Genome Browser
Species Human (GRCh38)
Location 3:177359694-177359716
Sequence GAGGAAGGCCCCTGCAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966201014_966201023 10 Left 966201014 3:177359661-177359683 CCACGGAGAGCGACCCTCGGCTC No data
Right 966201023 3:177359694-177359716 GAGGAAGGCCCCTGCAGGGTGGG No data
966201015_966201023 -3 Left 966201015 3:177359674-177359696 CCCTCGGCTCTGCAGCCTAAGAG No data
Right 966201023 3:177359694-177359716 GAGGAAGGCCCCTGCAGGGTGGG No data
966201012_966201023 13 Left 966201012 3:177359658-177359680 CCACCACGGAGAGCGACCCTCGG No data
Right 966201023 3:177359694-177359716 GAGGAAGGCCCCTGCAGGGTGGG No data
966201016_966201023 -4 Left 966201016 3:177359675-177359697 CCTCGGCTCTGCAGCCTAAGAGG No data
Right 966201023 3:177359694-177359716 GAGGAAGGCCCCTGCAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966201023 Original CRISPR GAGGAAGGCCCCTGCAGGGT GGG Intergenic