ID: 966201031

View in Genome Browser
Species Human (GRCh38)
Location 3:177359706-177359728
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966201019_966201031 -6 Left 966201019 3:177359689-177359711 CCTAAGAGGAAGGCCCCTGCAGG No data
Right 966201031 3:177359706-177359728 TGCAGGGTGGGGGAGGGAACAGG No data
966201016_966201031 8 Left 966201016 3:177359675-177359697 CCTCGGCTCTGCAGCCTAAGAGG No data
Right 966201031 3:177359706-177359728 TGCAGGGTGGGGGAGGGAACAGG No data
966201015_966201031 9 Left 966201015 3:177359674-177359696 CCCTCGGCTCTGCAGCCTAAGAG No data
Right 966201031 3:177359706-177359728 TGCAGGGTGGGGGAGGGAACAGG No data
966201012_966201031 25 Left 966201012 3:177359658-177359680 CCACCACGGAGAGCGACCCTCGG No data
Right 966201031 3:177359706-177359728 TGCAGGGTGGGGGAGGGAACAGG No data
966201014_966201031 22 Left 966201014 3:177359661-177359683 CCACGGAGAGCGACCCTCGGCTC No data
Right 966201031 3:177359706-177359728 TGCAGGGTGGGGGAGGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr