ID: 966201061

View in Genome Browser
Species Human (GRCh38)
Location 3:177359846-177359868
Sequence GCTCCTCTGATGTTTACGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966201061_966201064 -2 Left 966201061 3:177359846-177359868 CCAAACGTAAACATCAGAGGAGC No data
Right 966201064 3:177359867-177359889 GCGGGAACCCGAGCCCCGCCTGG No data
966201061_966201075 27 Left 966201061 3:177359846-177359868 CCAAACGTAAACATCAGAGGAGC No data
Right 966201075 3:177359896-177359918 CGGCAGCGACCCCGACGCCGCGG No data
966201061_966201066 3 Left 966201061 3:177359846-177359868 CCAAACGTAAACATCAGAGGAGC No data
Right 966201066 3:177359872-177359894 AACCCGAGCCCCGCCTGGGCTGG No data
966201061_966201070 7 Left 966201061 3:177359846-177359868 CCAAACGTAAACATCAGAGGAGC No data
Right 966201070 3:177359876-177359898 CGAGCCCCGCCTGGGCTGGGCGG No data
966201061_966201065 -1 Left 966201061 3:177359846-177359868 CCAAACGTAAACATCAGAGGAGC No data
Right 966201065 3:177359868-177359890 CGGGAACCCGAGCCCCGCCTGGG No data
966201061_966201067 4 Left 966201061 3:177359846-177359868 CCAAACGTAAACATCAGAGGAGC No data
Right 966201067 3:177359873-177359895 ACCCGAGCCCCGCCTGGGCTGGG No data
966201061_966201076 30 Left 966201061 3:177359846-177359868 CCAAACGTAAACATCAGAGGAGC No data
Right 966201076 3:177359899-177359921 CAGCGACCCCGACGCCGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966201061 Original CRISPR GCTCCTCTGATGTTTACGTT TGG (reversed) Intergenic