ID: 966201068

View in Genome Browser
Species Human (GRCh38)
Location 3:177359874-177359896
Sequence GCCCAGCCCAGGCGGGGCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966201068_966201076 2 Left 966201068 3:177359874-177359896 CCCGAGCCCCGCCTGGGCTGGGC No data
Right 966201076 3:177359899-177359921 CAGCGACCCCGACGCCGCGGCGG No data
966201068_966201075 -1 Left 966201068 3:177359874-177359896 CCCGAGCCCCGCCTGGGCTGGGC No data
Right 966201075 3:177359896-177359918 CGGCAGCGACCCCGACGCCGCGG No data
966201068_966201080 11 Left 966201068 3:177359874-177359896 CCCGAGCCCCGCCTGGGCTGGGC No data
Right 966201080 3:177359908-177359930 CGACGCCGCGGCGGCAGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966201068 Original CRISPR GCCCAGCCCAGGCGGGGCTC GGG (reversed) Intergenic
No off target data available for this crispr