ID: 966201071

View in Genome Browser
Species Human (GRCh38)
Location 3:177359880-177359902
Sequence GCTGCCGCCCAGCCCAGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966201071_966201076 -4 Left 966201071 3:177359880-177359902 CCCCGCCTGGGCTGGGCGGCAGC No data
Right 966201076 3:177359899-177359921 CAGCGACCCCGACGCCGCGGCGG No data
966201071_966201075 -7 Left 966201071 3:177359880-177359902 CCCCGCCTGGGCTGGGCGGCAGC No data
Right 966201075 3:177359896-177359918 CGGCAGCGACCCCGACGCCGCGG No data
966201071_966201080 5 Left 966201071 3:177359880-177359902 CCCCGCCTGGGCTGGGCGGCAGC No data
Right 966201080 3:177359908-177359930 CGACGCCGCGGCGGCAGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966201071 Original CRISPR GCTGCCGCCCAGCCCAGGCG GGG (reversed) Intergenic