ID: 966201072

View in Genome Browser
Species Human (GRCh38)
Location 3:177359881-177359903
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966201072_966201076 -5 Left 966201072 3:177359881-177359903 CCCGCCTGGGCTGGGCGGCAGCG No data
Right 966201076 3:177359899-177359921 CAGCGACCCCGACGCCGCGGCGG No data
966201072_966201075 -8 Left 966201072 3:177359881-177359903 CCCGCCTGGGCTGGGCGGCAGCG No data
Right 966201075 3:177359896-177359918 CGGCAGCGACCCCGACGCCGCGG No data
966201072_966201080 4 Left 966201072 3:177359881-177359903 CCCGCCTGGGCTGGGCGGCAGCG No data
Right 966201080 3:177359908-177359930 CGACGCCGCGGCGGCAGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966201072 Original CRISPR CGCTGCCGCCCAGCCCAGGC GGG (reversed) Intergenic