ID: 966201075

View in Genome Browser
Species Human (GRCh38)
Location 3:177359896-177359918
Sequence CGGCAGCGACCCCGACGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966201071_966201075 -7 Left 966201071 3:177359880-177359902 CCCCGCCTGGGCTGGGCGGCAGC No data
Right 966201075 3:177359896-177359918 CGGCAGCGACCCCGACGCCGCGG No data
966201061_966201075 27 Left 966201061 3:177359846-177359868 CCAAACGTAAACATCAGAGGAGC No data
Right 966201075 3:177359896-177359918 CGGCAGCGACCCCGACGCCGCGG No data
966201073_966201075 -9 Left 966201073 3:177359882-177359904 CCGCCTGGGCTGGGCGGCAGCGA No data
Right 966201075 3:177359896-177359918 CGGCAGCGACCCCGACGCCGCGG No data
966201068_966201075 -1 Left 966201068 3:177359874-177359896 CCCGAGCCCCGCCTGGGCTGGGC No data
Right 966201075 3:177359896-177359918 CGGCAGCGACCCCGACGCCGCGG No data
966201069_966201075 -2 Left 966201069 3:177359875-177359897 CCGAGCCCCGCCTGGGCTGGGCG No data
Right 966201075 3:177359896-177359918 CGGCAGCGACCCCGACGCCGCGG No data
966201072_966201075 -8 Left 966201072 3:177359881-177359903 CCCGCCTGGGCTGGGCGGCAGCG No data
Right 966201075 3:177359896-177359918 CGGCAGCGACCCCGACGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966201075 Original CRISPR CGGCAGCGACCCCGACGCCG CGG Intergenic
No off target data available for this crispr