ID: 966201076

View in Genome Browser
Species Human (GRCh38)
Location 3:177359899-177359921
Sequence CAGCGACCCCGACGCCGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966201069_966201076 1 Left 966201069 3:177359875-177359897 CCGAGCCCCGCCTGGGCTGGGCG No data
Right 966201076 3:177359899-177359921 CAGCGACCCCGACGCCGCGGCGG No data
966201068_966201076 2 Left 966201068 3:177359874-177359896 CCCGAGCCCCGCCTGGGCTGGGC No data
Right 966201076 3:177359899-177359921 CAGCGACCCCGACGCCGCGGCGG No data
966201061_966201076 30 Left 966201061 3:177359846-177359868 CCAAACGTAAACATCAGAGGAGC No data
Right 966201076 3:177359899-177359921 CAGCGACCCCGACGCCGCGGCGG No data
966201071_966201076 -4 Left 966201071 3:177359880-177359902 CCCCGCCTGGGCTGGGCGGCAGC No data
Right 966201076 3:177359899-177359921 CAGCGACCCCGACGCCGCGGCGG No data
966201074_966201076 -9 Left 966201074 3:177359885-177359907 CCTGGGCTGGGCGGCAGCGACCC No data
Right 966201076 3:177359899-177359921 CAGCGACCCCGACGCCGCGGCGG No data
966201072_966201076 -5 Left 966201072 3:177359881-177359903 CCCGCCTGGGCTGGGCGGCAGCG No data
Right 966201076 3:177359899-177359921 CAGCGACCCCGACGCCGCGGCGG No data
966201073_966201076 -6 Left 966201073 3:177359882-177359904 CCGCCTGGGCTGGGCGGCAGCGA No data
Right 966201076 3:177359899-177359921 CAGCGACCCCGACGCCGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966201076 Original CRISPR CAGCGACCCCGACGCCGCGG CGG Intergenic