ID: 966201080

View in Genome Browser
Species Human (GRCh38)
Location 3:177359908-177359930
Sequence CGACGCCGCGGCGGCAGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966201073_966201080 3 Left 966201073 3:177359882-177359904 CCGCCTGGGCTGGGCGGCAGCGA No data
Right 966201080 3:177359908-177359930 CGACGCCGCGGCGGCAGAGCCGG No data
966201074_966201080 0 Left 966201074 3:177359885-177359907 CCTGGGCTGGGCGGCAGCGACCC No data
Right 966201080 3:177359908-177359930 CGACGCCGCGGCGGCAGAGCCGG No data
966201069_966201080 10 Left 966201069 3:177359875-177359897 CCGAGCCCCGCCTGGGCTGGGCG No data
Right 966201080 3:177359908-177359930 CGACGCCGCGGCGGCAGAGCCGG No data
966201071_966201080 5 Left 966201071 3:177359880-177359902 CCCCGCCTGGGCTGGGCGGCAGC No data
Right 966201080 3:177359908-177359930 CGACGCCGCGGCGGCAGAGCCGG No data
966201072_966201080 4 Left 966201072 3:177359881-177359903 CCCGCCTGGGCTGGGCGGCAGCG No data
Right 966201080 3:177359908-177359930 CGACGCCGCGGCGGCAGAGCCGG No data
966201068_966201080 11 Left 966201068 3:177359874-177359896 CCCGAGCCCCGCCTGGGCTGGGC No data
Right 966201080 3:177359908-177359930 CGACGCCGCGGCGGCAGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966201080 Original CRISPR CGACGCCGCGGCGGCAGAGC CGG Intergenic