ID: 966201497

View in Genome Browser
Species Human (GRCh38)
Location 3:177363065-177363087
Sequence TGCAGAGTGGTCTTTCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966201497_966201504 16 Left 966201497 3:177363065-177363087 CCACAGGGAAAGACCACTCTGCA No data
Right 966201504 3:177363104-177363126 ATCCAGTGTGGTTCCGAGACTGG No data
966201497_966201501 4 Left 966201497 3:177363065-177363087 CCACAGGGAAAGACCACTCTGCA No data
Right 966201501 3:177363092-177363114 TCAACGGAACCCATCCAGTGTGG No data
966201497_966201506 19 Left 966201497 3:177363065-177363087 CCACAGGGAAAGACCACTCTGCA No data
Right 966201506 3:177363107-177363129 CAGTGTGGTTCCGAGACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966201497 Original CRISPR TGCAGAGTGGTCTTTCCCTG TGG (reversed) Intergenic
No off target data available for this crispr