ID: 966204005

View in Genome Browser
Species Human (GRCh38)
Location 3:177387470-177387492
Sequence AACACCAATGTGGGTATAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966204002_966204005 9 Left 966204002 3:177387438-177387460 CCTGGTAGTAGGAGATTTACAAA No data
Right 966204005 3:177387470-177387492 AACACCAATGTGGGTATAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966204005 Original CRISPR AACACCAATGTGGGTATAAT CGG Intergenic
No off target data available for this crispr