ID: 966206512

View in Genome Browser
Species Human (GRCh38)
Location 3:177412035-177412057
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966206512_966206514 9 Left 966206512 3:177412035-177412057 CCACCTTCATTCTGATATGTTAC No data
Right 966206514 3:177412067-177412089 TCTTATATGATTAAGTTCTTTGG No data
966206512_966206515 22 Left 966206512 3:177412035-177412057 CCACCTTCATTCTGATATGTTAC No data
Right 966206515 3:177412080-177412102 AGTTCTTTGGAACTAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966206512 Original CRISPR GTAACATATCAGAATGAAGG TGG (reversed) Intergenic
No off target data available for this crispr