ID: 966212706

View in Genome Browser
Species Human (GRCh38)
Location 3:177469544-177469566
Sequence GAAGTCTGCTTTTCTAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966212704_966212706 -2 Left 966212704 3:177469523-177469545 CCCACTATAGGCGGGAATTCAGA No data
Right 966212706 3:177469544-177469566 GAAGTCTGCTTTTCTAAGACAGG No data
966212705_966212706 -3 Left 966212705 3:177469524-177469546 CCACTATAGGCGGGAATTCAGAA No data
Right 966212706 3:177469544-177469566 GAAGTCTGCTTTTCTAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966212706 Original CRISPR GAAGTCTGCTTTTCTAAGAC AGG Intergenic
No off target data available for this crispr