ID: 966213606

View in Genome Browser
Species Human (GRCh38)
Location 3:177478326-177478348
Sequence GCACTATTACAGTCTAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966213606_966213608 -9 Left 966213606 3:177478326-177478348 CCCTCTTTAGACTGTAATAGTGC No data
Right 966213608 3:177478340-177478362 TAATAGTGCTGAGTTCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966213606 Original CRISPR GCACTATTACAGTCTAAAGA GGG (reversed) Intergenic
No off target data available for this crispr