ID: 966216721

View in Genome Browser
Species Human (GRCh38)
Location 3:177511034-177511056
Sequence GGCATCTGGAACCATCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966216717_966216721 -8 Left 966216717 3:177511019-177511041 CCAAAATAACATGATGGCATCTG No data
Right 966216721 3:177511034-177511056 GGCATCTGGAACCATCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966216721 Original CRISPR GGCATCTGGAACCATCTGGA GGG Intergenic
No off target data available for this crispr