ID: 966217056

View in Genome Browser
Species Human (GRCh38)
Location 3:177514808-177514830
Sequence TTCCAGACAAAGCATCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966217056_966217064 22 Left 966217056 3:177514808-177514830 CCTTGGTGATGCTTTGTCTGGAA No data
Right 966217064 3:177514853-177514875 CTTAGAGAAACTGGGAGGCAGGG No data
966217056_966217057 -4 Left 966217056 3:177514808-177514830 CCTTGGTGATGCTTTGTCTGGAA No data
Right 966217057 3:177514827-177514849 GGAAATTCCTCCTTCTTATTTGG No data
966217056_966217060 13 Left 966217056 3:177514808-177514830 CCTTGGTGATGCTTTGTCTGGAA No data
Right 966217060 3:177514844-177514866 ATTTGGCAACTTAGAGAAACTGG No data
966217056_966217061 14 Left 966217056 3:177514808-177514830 CCTTGGTGATGCTTTGTCTGGAA No data
Right 966217061 3:177514845-177514867 TTTGGCAACTTAGAGAAACTGGG No data
966217056_966217062 17 Left 966217056 3:177514808-177514830 CCTTGGTGATGCTTTGTCTGGAA No data
Right 966217062 3:177514848-177514870 GGCAACTTAGAGAAACTGGGAGG No data
966217056_966217063 21 Left 966217056 3:177514808-177514830 CCTTGGTGATGCTTTGTCTGGAA No data
Right 966217063 3:177514852-177514874 ACTTAGAGAAACTGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966217056 Original CRISPR TTCCAGACAAAGCATCACCA AGG (reversed) Intergenic