ID: 966217058

View in Genome Browser
Species Human (GRCh38)
Location 3:177514834-177514856
Sequence TAAGTTGCCAAATAAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966217058_966217062 -9 Left 966217058 3:177514834-177514856 CCTCCTTCTTATTTGGCAACTTA No data
Right 966217062 3:177514848-177514870 GGCAACTTAGAGAAACTGGGAGG No data
966217058_966217065 18 Left 966217058 3:177514834-177514856 CCTCCTTCTTATTTGGCAACTTA No data
Right 966217065 3:177514875-177514897 GATGTTGAGAGAAATATGACAGG No data
966217058_966217063 -5 Left 966217058 3:177514834-177514856 CCTCCTTCTTATTTGGCAACTTA No data
Right 966217063 3:177514852-177514874 ACTTAGAGAAACTGGGAGGCAGG No data
966217058_966217064 -4 Left 966217058 3:177514834-177514856 CCTCCTTCTTATTTGGCAACTTA No data
Right 966217064 3:177514853-177514875 CTTAGAGAAACTGGGAGGCAGGG No data
966217058_966217066 19 Left 966217058 3:177514834-177514856 CCTCCTTCTTATTTGGCAACTTA No data
Right 966217066 3:177514876-177514898 ATGTTGAGAGAAATATGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966217058 Original CRISPR TAAGTTGCCAAATAAGAAGG AGG (reversed) Intergenic