ID: 966217059

View in Genome Browser
Species Human (GRCh38)
Location 3:177514837-177514859
Sequence CTCTAAGTTGCCAAATAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966217059_966217065 15 Left 966217059 3:177514837-177514859 CCTTCTTATTTGGCAACTTAGAG No data
Right 966217065 3:177514875-177514897 GATGTTGAGAGAAATATGACAGG No data
966217059_966217063 -8 Left 966217059 3:177514837-177514859 CCTTCTTATTTGGCAACTTAGAG No data
Right 966217063 3:177514852-177514874 ACTTAGAGAAACTGGGAGGCAGG No data
966217059_966217068 30 Left 966217059 3:177514837-177514859 CCTTCTTATTTGGCAACTTAGAG No data
Right 966217068 3:177514890-177514912 ATGACAGGGTAAGACCATTTGGG No data
966217059_966217066 16 Left 966217059 3:177514837-177514859 CCTTCTTATTTGGCAACTTAGAG No data
Right 966217066 3:177514876-177514898 ATGTTGAGAGAAATATGACAGGG No data
966217059_966217064 -7 Left 966217059 3:177514837-177514859 CCTTCTTATTTGGCAACTTAGAG No data
Right 966217064 3:177514853-177514875 CTTAGAGAAACTGGGAGGCAGGG No data
966217059_966217067 29 Left 966217059 3:177514837-177514859 CCTTCTTATTTGGCAACTTAGAG No data
Right 966217067 3:177514889-177514911 TATGACAGGGTAAGACCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966217059 Original CRISPR CTCTAAGTTGCCAAATAAGA AGG (reversed) Intergenic