ID: 966217063

View in Genome Browser
Species Human (GRCh38)
Location 3:177514852-177514874
Sequence ACTTAGAGAAACTGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966217056_966217063 21 Left 966217056 3:177514808-177514830 CCTTGGTGATGCTTTGTCTGGAA No data
Right 966217063 3:177514852-177514874 ACTTAGAGAAACTGGGAGGCAGG No data
966217059_966217063 -8 Left 966217059 3:177514837-177514859 CCTTCTTATTTGGCAACTTAGAG No data
Right 966217063 3:177514852-177514874 ACTTAGAGAAACTGGGAGGCAGG No data
966217058_966217063 -5 Left 966217058 3:177514834-177514856 CCTCCTTCTTATTTGGCAACTTA No data
Right 966217063 3:177514852-177514874 ACTTAGAGAAACTGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966217063 Original CRISPR ACTTAGAGAAACTGGGAGGC AGG Intergenic