ID: 966219497

View in Genome Browser
Species Human (GRCh38)
Location 3:177536220-177536242
Sequence GAGAGTCAAGTGAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966219492_966219497 -1 Left 966219492 3:177536198-177536220 CCTGTGATGGTGGTGGTGCTGGG No data
Right 966219497 3:177536220-177536242 GAGAGTCAAGTGAAGGTGGGAGG No data
966219490_966219497 5 Left 966219490 3:177536192-177536214 CCGTGGCCTGTGATGGTGGTGGT No data
Right 966219497 3:177536220-177536242 GAGAGTCAAGTGAAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966219497 Original CRISPR GAGAGTCAAGTGAAGGTGGG AGG Intergenic
No off target data available for this crispr