ID: 966221353 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:177554421-177554443 |
| Sequence | CTTTCAGTGCTGAAGGTACT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 966221350_966221353 | -6 | Left | 966221350 | 3:177554404-177554426 | CCATTGCCAGCTGTAGACTTTCA | No data | ||
| Right | 966221353 | 3:177554421-177554443 | CTTTCAGTGCTGAAGGTACTTGG | No data | ||||
| 966221349_966221353 | 19 | Left | 966221349 | 3:177554379-177554401 | CCTTGTTTTAATCTTTGTGGTAC | No data | ||
| Right | 966221353 | 3:177554421-177554443 | CTTTCAGTGCTGAAGGTACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 966221353 | Original CRISPR | CTTTCAGTGCTGAAGGTACT TGG | Intergenic | ||
| No off target data available for this crispr | |||||