ID: 966221353

View in Genome Browser
Species Human (GRCh38)
Location 3:177554421-177554443
Sequence CTTTCAGTGCTGAAGGTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966221350_966221353 -6 Left 966221350 3:177554404-177554426 CCATTGCCAGCTGTAGACTTTCA No data
Right 966221353 3:177554421-177554443 CTTTCAGTGCTGAAGGTACTTGG No data
966221349_966221353 19 Left 966221349 3:177554379-177554401 CCTTGTTTTAATCTTTGTGGTAC No data
Right 966221353 3:177554421-177554443 CTTTCAGTGCTGAAGGTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966221353 Original CRISPR CTTTCAGTGCTGAAGGTACT TGG Intergenic
No off target data available for this crispr