ID: 966222162

View in Genome Browser
Species Human (GRCh38)
Location 3:177561503-177561525
Sequence GGATAACAAATTCAGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966222162_966222169 12 Left 966222162 3:177561503-177561525 CCAGGCTCCTGAATTTGTTATCC No data
Right 966222169 3:177561538-177561560 GGTGAAGAAAGCCCCCTGTTGGG No data
966222162_966222168 11 Left 966222162 3:177561503-177561525 CCAGGCTCCTGAATTTGTTATCC No data
Right 966222168 3:177561537-177561559 GGGTGAAGAAAGCCCCCTGTTGG No data
966222162_966222164 -10 Left 966222162 3:177561503-177561525 CCAGGCTCCTGAATTTGTTATCC No data
Right 966222164 3:177561516-177561538 TTTGTTATCCCTGTAGAAAATGG No data
966222162_966222165 -9 Left 966222162 3:177561503-177561525 CCAGGCTCCTGAATTTGTTATCC No data
Right 966222165 3:177561517-177561539 TTGTTATCCCTGTAGAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966222162 Original CRISPR GGATAACAAATTCAGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr