ID: 966222163

View in Genome Browser
Species Human (GRCh38)
Location 3:177561510-177561532
Sequence TCTACAGGGATAACAAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966222163_966222175 30 Left 966222163 3:177561510-177561532 CCTGAATTTGTTATCCCTGTAGA No data
Right 966222175 3:177561563-177561585 GTTTCTCTAGCACTCATTGGAGG No data
966222163_966222174 27 Left 966222163 3:177561510-177561532 CCTGAATTTGTTATCCCTGTAGA No data
Right 966222174 3:177561560-177561582 GCTGTTTCTCTAGCACTCATTGG No data
966222163_966222169 5 Left 966222163 3:177561510-177561532 CCTGAATTTGTTATCCCTGTAGA No data
Right 966222169 3:177561538-177561560 GGTGAAGAAAGCCCCCTGTTGGG No data
966222163_966222168 4 Left 966222163 3:177561510-177561532 CCTGAATTTGTTATCCCTGTAGA No data
Right 966222168 3:177561537-177561559 GGGTGAAGAAAGCCCCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966222163 Original CRISPR TCTACAGGGATAACAAATTC AGG (reversed) Intergenic
No off target data available for this crispr