ID: 966222168

View in Genome Browser
Species Human (GRCh38)
Location 3:177561537-177561559
Sequence GGGTGAAGAAAGCCCCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966222162_966222168 11 Left 966222162 3:177561503-177561525 CCAGGCTCCTGAATTTGTTATCC No data
Right 966222168 3:177561537-177561559 GGGTGAAGAAAGCCCCCTGTTGG No data
966222163_966222168 4 Left 966222163 3:177561510-177561532 CCTGAATTTGTTATCCCTGTAGA No data
Right 966222168 3:177561537-177561559 GGGTGAAGAAAGCCCCCTGTTGG No data
966222166_966222168 -10 Left 966222166 3:177561524-177561546 CCCTGTAGAAAATGGGTGAAGAA No data
Right 966222168 3:177561537-177561559 GGGTGAAGAAAGCCCCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966222168 Original CRISPR GGGTGAAGAAAGCCCCCTGT TGG Intergenic
No off target data available for this crispr