ID: 966222174

View in Genome Browser
Species Human (GRCh38)
Location 3:177561560-177561582
Sequence GCTGTTTCTCTAGCACTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966222167_966222174 12 Left 966222167 3:177561525-177561547 CCTGTAGAAAATGGGTGAAGAAA No data
Right 966222174 3:177561560-177561582 GCTGTTTCTCTAGCACTCATTGG No data
966222163_966222174 27 Left 966222163 3:177561510-177561532 CCTGAATTTGTTATCCCTGTAGA No data
Right 966222174 3:177561560-177561582 GCTGTTTCTCTAGCACTCATTGG No data
966222166_966222174 13 Left 966222166 3:177561524-177561546 CCCTGTAGAAAATGGGTGAAGAA No data
Right 966222174 3:177561560-177561582 GCTGTTTCTCTAGCACTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966222174 Original CRISPR GCTGTTTCTCTAGCACTCAT TGG Intergenic
No off target data available for this crispr