ID: 966222212

View in Genome Browser
Species Human (GRCh38)
Location 3:177562039-177562061
Sequence CCTGCCCTGCAGCTCTTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966222212_966222216 -6 Left 966222212 3:177562039-177562061 CCCTGAAAGAGCTGCAGGGCAGG No data
Right 966222216 3:177562056-177562078 GGCAGGTGTCGATATTATGGTGG No data
966222212_966222215 -9 Left 966222212 3:177562039-177562061 CCCTGAAAGAGCTGCAGGGCAGG No data
Right 966222215 3:177562053-177562075 CAGGGCAGGTGTCGATATTATGG No data
966222212_966222217 -5 Left 966222212 3:177562039-177562061 CCCTGAAAGAGCTGCAGGGCAGG No data
Right 966222217 3:177562057-177562079 GCAGGTGTCGATATTATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966222212 Original CRISPR CCTGCCCTGCAGCTCTTTCA GGG (reversed) Intergenic
No off target data available for this crispr