ID: 966225748

View in Genome Browser
Species Human (GRCh38)
Location 3:177596238-177596260
Sequence AACCTCTTGATGAAGCTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966225748_966225755 30 Left 966225748 3:177596238-177596260 CCTATTAGCTTCATCAAGAGGTT No data
Right 966225755 3:177596291-177596313 ATGAATTTTCAGCTGAATATAGG No data
966225748_966225749 -6 Left 966225748 3:177596238-177596260 CCTATTAGCTTCATCAAGAGGTT No data
Right 966225749 3:177596255-177596277 GAGGTTTTATCCCCTCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966225748 Original CRISPR AACCTCTTGATGAAGCTAAT AGG (reversed) Intergenic
No off target data available for this crispr