ID: 966225749

View in Genome Browser
Species Human (GRCh38)
Location 3:177596255-177596277
Sequence GAGGTTTTATCCCCTCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966225744_966225749 -1 Left 966225744 3:177596233-177596255 CCCCTCCTATTAGCTTCATCAAG No data
Right 966225749 3:177596255-177596277 GAGGTTTTATCCCCTCCTCTTGG No data
966225745_966225749 -2 Left 966225745 3:177596234-177596256 CCCTCCTATTAGCTTCATCAAGA No data
Right 966225749 3:177596255-177596277 GAGGTTTTATCCCCTCCTCTTGG No data
966225748_966225749 -6 Left 966225748 3:177596238-177596260 CCTATTAGCTTCATCAAGAGGTT No data
Right 966225749 3:177596255-177596277 GAGGTTTTATCCCCTCCTCTTGG No data
966225746_966225749 -3 Left 966225746 3:177596235-177596257 CCTCCTATTAGCTTCATCAAGAG No data
Right 966225749 3:177596255-177596277 GAGGTTTTATCCCCTCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966225749 Original CRISPR GAGGTTTTATCCCCTCCTCT TGG Intergenic
No off target data available for this crispr