ID: 966225755

View in Genome Browser
Species Human (GRCh38)
Location 3:177596291-177596313
Sequence ATGAATTTTCAGCTGAATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966225752_966225755 1 Left 966225752 3:177596267-177596289 CCTCCTCTTGGCTTTCAAACCAA No data
Right 966225755 3:177596291-177596313 ATGAATTTTCAGCTGAATATAGG No data
966225750_966225755 3 Left 966225750 3:177596265-177596287 CCCCTCCTCTTGGCTTTCAAACC No data
Right 966225755 3:177596291-177596313 ATGAATTTTCAGCTGAATATAGG No data
966225748_966225755 30 Left 966225748 3:177596238-177596260 CCTATTAGCTTCATCAAGAGGTT No data
Right 966225755 3:177596291-177596313 ATGAATTTTCAGCTGAATATAGG No data
966225751_966225755 2 Left 966225751 3:177596266-177596288 CCCTCCTCTTGGCTTTCAAACCA No data
Right 966225755 3:177596291-177596313 ATGAATTTTCAGCTGAATATAGG No data
966225753_966225755 -2 Left 966225753 3:177596270-177596292 CCTCTTGGCTTTCAAACCAACAT No data
Right 966225755 3:177596291-177596313 ATGAATTTTCAGCTGAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966225755 Original CRISPR ATGAATTTTCAGCTGAATAT AGG Intergenic
No off target data available for this crispr