ID: 966226505

View in Genome Browser
Species Human (GRCh38)
Location 3:177603762-177603784
Sequence GTCAAATGTAGGGCTGGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966226500_966226505 7 Left 966226500 3:177603732-177603754 CCATGAAGAATATGATAAACTCT No data
Right 966226505 3:177603762-177603784 GTCAAATGTAGGGCTGGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966226505 Original CRISPR GTCAAATGTAGGGCTGGCTA AGG Intergenic
No off target data available for this crispr