ID: 966228148

View in Genome Browser
Species Human (GRCh38)
Location 3:177620270-177620292
Sequence GCCTCCCAGAACATAAACGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966228148_966228154 17 Left 966228148 3:177620270-177620292 CCGTCGTTTATGTTCTGGGAGGC No data
Right 966228154 3:177620310-177620332 TATTCTGAAAGGGAAAGACATGG No data
966228148_966228153 7 Left 966228148 3:177620270-177620292 CCGTCGTTTATGTTCTGGGAGGC No data
Right 966228153 3:177620300-177620322 AGTCAGCAAGTATTCTGAAAGGG No data
966228148_966228158 25 Left 966228148 3:177620270-177620292 CCGTCGTTTATGTTCTGGGAGGC No data
Right 966228158 3:177620318-177620340 AAGGGAAAGACATGGTGGGGAGG No data
966228148_966228152 6 Left 966228148 3:177620270-177620292 CCGTCGTTTATGTTCTGGGAGGC No data
Right 966228152 3:177620299-177620321 GAGTCAGCAAGTATTCTGAAAGG No data
966228148_966228156 21 Left 966228148 3:177620270-177620292 CCGTCGTTTATGTTCTGGGAGGC No data
Right 966228156 3:177620314-177620336 CTGAAAGGGAAAGACATGGTGGG No data
966228148_966228155 20 Left 966228148 3:177620270-177620292 CCGTCGTTTATGTTCTGGGAGGC No data
Right 966228155 3:177620313-177620335 TCTGAAAGGGAAAGACATGGTGG No data
966228148_966228157 22 Left 966228148 3:177620270-177620292 CCGTCGTTTATGTTCTGGGAGGC No data
Right 966228157 3:177620315-177620337 TGAAAGGGAAAGACATGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966228148 Original CRISPR GCCTCCCAGAACATAAACGA CGG (reversed) Intergenic
No off target data available for this crispr