ID: 966229119

View in Genome Browser
Species Human (GRCh38)
Location 3:177631535-177631557
Sequence TCTGGGGCCCAGAAGCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966229119_966229123 4 Left 966229119 3:177631535-177631557 CCTCAAGGCTTCTGGGCCCCAGA No data
Right 966229123 3:177631562-177631584 TTGTTGCTTTTTTTTTTTTGAGG No data
966229119_966229124 28 Left 966229119 3:177631535-177631557 CCTCAAGGCTTCTGGGCCCCAGA No data
Right 966229124 3:177631586-177631608 AGAGTCTCGCTCTGTTGCCCAGG 0: 4406
1: 35153
2: 108095
3: 167633
4: 195830

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966229119 Original CRISPR TCTGGGGCCCAGAAGCCTTG AGG (reversed) Intergenic
No off target data available for this crispr