ID: 966230077

View in Genome Browser
Species Human (GRCh38)
Location 3:177642104-177642126
Sequence CAGGTGAACGACAGGGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966230072_966230077 -5 Left 966230072 3:177642086-177642108 CCTTCTGGGCTGAGTGGGCAGGT No data
Right 966230077 3:177642104-177642126 CAGGTGAACGACAGGGCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966230077 Original CRISPR CAGGTGAACGACAGGGCGGG AGG Intergenic
No off target data available for this crispr