ID: 966233781

View in Genome Browser
Species Human (GRCh38)
Location 3:177677786-177677808
Sequence GCATCAGTATTATCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966233780_966233781 16 Left 966233780 3:177677747-177677769 CCAAATTACTATGCTATGTTTTT No data
Right 966233781 3:177677786-177677808 GCATCAGTATTATCTGTTACTGG No data
966233779_966233781 17 Left 966233779 3:177677746-177677768 CCCAAATTACTATGCTATGTTTT No data
Right 966233781 3:177677786-177677808 GCATCAGTATTATCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966233781 Original CRISPR GCATCAGTATTATCTGTTAC TGG Intergenic
No off target data available for this crispr