ID: 966235352

View in Genome Browser
Species Human (GRCh38)
Location 3:177695490-177695512
Sequence GAGCTTGTAGGAAGGCCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966235348_966235352 0 Left 966235348 3:177695467-177695489 CCATAGGATATTTATTTATCTTT No data
Right 966235352 3:177695490-177695512 GAGCTTGTAGGAAGGCCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966235352 Original CRISPR GAGCTTGTAGGAAGGCCGGC TGG Intergenic
No off target data available for this crispr