ID: 966236131

View in Genome Browser
Species Human (GRCh38)
Location 3:177703877-177703899
Sequence GGGGGCAGTTGCAGGCGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966236131_966236136 -9 Left 966236131 3:177703877-177703899 CCATCTCGCCTGCAACTGCCCCC No data
Right 966236136 3:177703891-177703913 ACTGCCCCCAGGCCGGGTCATGG No data
966236131_966236137 -8 Left 966236131 3:177703877-177703899 CCATCTCGCCTGCAACTGCCCCC No data
Right 966236137 3:177703892-177703914 CTGCCCCCAGGCCGGGTCATGGG No data
966236131_966236143 22 Left 966236131 3:177703877-177703899 CCATCTCGCCTGCAACTGCCCCC No data
Right 966236143 3:177703922-177703944 TAGAGTGACATCCATATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966236131 Original CRISPR GGGGGCAGTTGCAGGCGAGA TGG (reversed) Intergenic