ID: 966236134

View in Genome Browser
Species Human (GRCh38)
Location 3:177703885-177703907
Sequence CCCGGCCTGGGGGCAGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966236134_966236143 14 Left 966236134 3:177703885-177703907 CCTGCAACTGCCCCCAGGCCGGG No data
Right 966236143 3:177703922-177703944 TAGAGTGACATCCATATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966236134 Original CRISPR CCCGGCCTGGGGGCAGTTGC AGG (reversed) Intergenic