ID: 966236137

View in Genome Browser
Species Human (GRCh38)
Location 3:177703892-177703914
Sequence CTGCCCCCAGGCCGGGTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966236131_966236137 -8 Left 966236131 3:177703877-177703899 CCATCTCGCCTGCAACTGCCCCC No data
Right 966236137 3:177703892-177703914 CTGCCCCCAGGCCGGGTCATGGG No data
966236130_966236137 19 Left 966236130 3:177703850-177703872 CCAGAACAAAGAAGTATTTTATT No data
Right 966236137 3:177703892-177703914 CTGCCCCCAGGCCGGGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966236137 Original CRISPR CTGCCCCCAGGCCGGGTCAT GGG Intergenic