ID: 966236138

View in Genome Browser
Species Human (GRCh38)
Location 3:177703895-177703917
Sequence CAGCCCATGACCCGGCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966236138_966236143 4 Left 966236138 3:177703895-177703917 CCCCCAGGCCGGGTCATGGGCTG No data
Right 966236143 3:177703922-177703944 TAGAGTGACATCCATATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966236138 Original CRISPR CAGCCCATGACCCGGCCTGG GGG (reversed) Intergenic