ID: 966236141

View in Genome Browser
Species Human (GRCh38)
Location 3:177703898-177703920
Sequence TCTCAGCCCATGACCCGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966236141_966236143 1 Left 966236141 3:177703898-177703920 CCAGGCCGGGTCATGGGCTGAGA No data
Right 966236143 3:177703922-177703944 TAGAGTGACATCCATATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966236141 Original CRISPR TCTCAGCCCATGACCCGGCC TGG (reversed) Intergenic