ID: 966236142

View in Genome Browser
Species Human (GRCh38)
Location 3:177703903-177703925
Sequence TCTATTCTCAGCCCATGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966236142_966236143 -4 Left 966236142 3:177703903-177703925 CCGGGTCATGGGCTGAGAATAGA No data
Right 966236143 3:177703922-177703944 TAGAGTGACATCCATATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966236142 Original CRISPR TCTATTCTCAGCCCATGACC CGG (reversed) Intergenic