ID: 966236142 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:177703903-177703925 |
| Sequence | TCTATTCTCAGCCCATGACC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 966236142_966236143 | -4 | Left | 966236142 | 3:177703903-177703925 | CCGGGTCATGGGCTGAGAATAGA | No data | ||
| Right | 966236143 | 3:177703922-177703944 | TAGAGTGACATCCATATTTGAGG | 0: 1 1: 0 2: 0 3: 12 4: 116 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 966236142 | Original CRISPR | TCTATTCTCAGCCCATGACC CGG (reversed) | Intergenic | ||