ID: 966236143

View in Genome Browser
Species Human (GRCh38)
Location 3:177703922-177703944
Sequence TAGAGTGACATCCATATTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966236141_966236143 1 Left 966236141 3:177703898-177703920 CCAGGCCGGGTCATGGGCTGAGA No data
Right 966236143 3:177703922-177703944 TAGAGTGACATCCATATTTGAGG No data
966236139_966236143 3 Left 966236139 3:177703896-177703918 CCCCAGGCCGGGTCATGGGCTGA No data
Right 966236143 3:177703922-177703944 TAGAGTGACATCCATATTTGAGG No data
966236140_966236143 2 Left 966236140 3:177703897-177703919 CCCAGGCCGGGTCATGGGCTGAG No data
Right 966236143 3:177703922-177703944 TAGAGTGACATCCATATTTGAGG No data
966236134_966236143 14 Left 966236134 3:177703885-177703907 CCTGCAACTGCCCCCAGGCCGGG No data
Right 966236143 3:177703922-177703944 TAGAGTGACATCCATATTTGAGG No data
966236131_966236143 22 Left 966236131 3:177703877-177703899 CCATCTCGCCTGCAACTGCCCCC No data
Right 966236143 3:177703922-177703944 TAGAGTGACATCCATATTTGAGG No data
966236138_966236143 4 Left 966236138 3:177703895-177703917 CCCCCAGGCCGGGTCATGGGCTG No data
Right 966236143 3:177703922-177703944 TAGAGTGACATCCATATTTGAGG No data
966236142_966236143 -4 Left 966236142 3:177703903-177703925 CCGGGTCATGGGCTGAGAATAGA No data
Right 966236143 3:177703922-177703944 TAGAGTGACATCCATATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966236143 Original CRISPR TAGAGTGACATCCATATTTG AGG Intergenic